The Term ââåkinetic Artã¢ââ Is a Type of Art
Nucleic Acids Res. 2009 November; 37(20): 6970–6983.
The Staphylococcus aureus pSK41 plasmid-encoded ArtA poly peptide is a chief regulator of plasmid transmission genes and contains a RHH motif used in alternate DNA-binding modes
Lisheng Ni
aneDepartment of Biochemistry and Molecular Biology, University of Texas, M.D. Anderson Cancer Eye, Unit m, Houston, TX 77030, USA, 2School of Biological Sciences, University of Sydney, Sydney, New South Wales 2006 and 3School of Biological Sciences, Flinders University, Adelaide, Southward Australia, Australia
Slade O. Jensen
1Department of Biochemistry and Molecular Biology, University of Texas, G.D. Anderson Cancer Center, Unit 1000, Houston, TX 77030, U.s.a., iiSchool of Biological Sciences, Academy of Sydney, Sydney, New S Wales 2006 and iiiSchool of Biological Sciences, Flinders Academy, Adelaide, South Australia, Australia
Nam Ky Tonthat
oneSection of Biochemistry and Molecular Biology, Academy of Texas, Yard.D. Anderson Cancer Center, Unit 1000, Houston, TX 77030, USA, 2School of Biological Sciences, University of Sydney, Sydney, New Due south Wales 2006 and 3School of Biological Sciences, Flinders University, Adelaide, Southward Australia, Commonwealth of australia
Tracey Berg
1Department of Biochemistry and Molecular Biological science, University of Texas, Thou.D. Anderson Cancer Heart, Unit thousand, Houston, TX 77030, USA, 2Schoolhouse of Biological Sciences, University of Sydney, Sydney, New South Wales 2006 and iiiSchoolhouse of Biological Sciences, Flinders University, Adelaide, South Commonwealth of australia, Australia
Stephen M. Kwong
aneDepartment of Biochemistry and Molecular Biology, Academy of Texas, 1000.D. Anderson Cancer Eye, Unit 1000, Houston, TX 77030, USA, 2School of Biological Sciences, University of Sydney, Sydney, New South Wales 2006 and threeSchoolhouse of Biological Sciences, Flinders University, Adelaide, Southward Commonwealth of australia, Commonwealth of australia
Fiona H. Ten. Guan
1Department of Biochemistry and Molecular Biological science, University of Texas, One thousand.D. Anderson Cancer Heart, Unit chiliad, Houston, TX 77030, U.s., 2School of Biological Sciences, University of Sydney, Sydney, New S Wales 2006 and 3School of Biological Sciences, Flinders University, Adelaide, South Commonwealth of australia, Commonwealth of australia
Melissa H. Brown
1Department of Biochemistry and Molecular Biology, Academy of Texas, M.D. Anderson Cancer Center, Unit 1000, Houston, TX 77030, Usa, 2Schoolhouse of Biological Sciences, University of Sydney, Sydney, New South Wales 2006 and 3School of Biological Sciences, Flinders University, Adelaide, Southward Australia, Commonwealth of australia
Ronald A. Skurray
1Department of Biochemistry and Molecular Biological science, Academy of Texas, M.D. Anderson Cancer Center, Unit 1000, Houston, TX 77030, USA, 2School of Biological Sciences, University of Sydney, Sydney, New South Wales 2006 and threeSchool of Biological Sciences, Flinders University, Adelaide, S Australia, Commonwealth of australia
Neville Firth
1Department of Biochemistry and Molecular Biology, University of Texas, Yard.D. Anderson Cancer Center, Unit 1000, Houston, TX 77030, USA, 2School of Biological Sciences, University of Sydney, Sydney, New South Wales 2006 and 3School of Biological Sciences, Flinders University, Adelaide, South Australia, Australia
Maria A. Schumacher
1Department of Biochemistry and Molecular Biology, Academy of Texas, Thou.D. Anderson Cancer Heart, Unit chiliad, Houston, TX 77030, USA, twoSchool of Biological Sciences, Academy of Sydney, Sydney, New S Wales 2006 and iiiSchool of Biological Sciences, Flinders University, Adelaide, S Australia, Australia
Received 2009 Jul 29; Revised 2009 Aug 24; Accepted 2009 Aug 27.
- Supplementary Materials
-
[Supplementary Data]
GUID: 98FBD281-DFE1-42DF-AEC5-4A01ABEFCE93
GUID: C01BD67F-4364-4C78-A1A6-55663D7497BA
Abstract
Plasmids harbored by Staphylococcus aureus are a major contributor to the spread of bacterial multi-drug resistance. Plasmid conjugation and partitioning are disquisitional to the broadcasting and inheritance of such plasmids. Here, we demonstrate that the ArtA protein encoded by the S. aureus multi-resistance plasmid pSK41 is a global transcriptional regulator of pSK41 genes, including those involved in conjugation and segregation. ArtA shows no sequence homology to any structurally characterized Dna-binding protein. To elucidate the mechanism by which it specifically recognizes its DNA site, we obtained the structure of ArtA spring to its cognate operator, ACATGACATG. The construction reveals that ArtA is representative of a new family of ribbon–helix–helix (RHH) DNA-binding proteins that contain extended, N-final basic motifs. Strikingly, unlike most well-studied RHH proteins ArtA binds its cognate operators as a dimer. However, we demonstrate that it is also able to recognize an atypical operator site by bounden as a dimer-of-dimers and the extended N-concluding regions of ArtA were shown to be essential for this dimer-of-dimer binding fashion. Thus, these data signal that ArtA is a master regulator of genes critical for both horizontal and vertical manual of pSK41 and that it can recognize Dna utilizing alternating binding modes.
INTRODUCTION
The emergence of multi-drug resistant bacteria has now go a global threat to human health. Indeed, more people in the United states now die from multi-drug resistant forms of Staphylococcus aureus than AIDS (1–4). Multi-drug resistance determinants in Due south. aureus are found chromosomally and on plasmids (v). The largest staphylococcal plasmids are the conjugative multi-resistance plasmids, which are typified by the epitome pSK41 (6). Members of the pSK41 family of plasmids encode a wide array of resistance phenotypes; for example, pLW1043 confers resistance to five different classes of anti-microbial agents. The conjugation organization of these plasmids makes them efficient vehicles of horizontal transfer, and they therefore represent of import mediators of multi-drug resistance transmission between bacterial strains, and hence a significant medical threat.
pSK41-like plasmids bear witness a loftier caste of structural and sequence similarity such that a conserved plasmid backbone can be recognized, into which distinct Dna segments encoding diverse resistance genes take been integrated, frequently mediated by the activities of the insertion element IS257 that consequently flanks many of these segments (5). In pSK41, resistance segments split the courage into two segments; viz., the transfer (tra) region that contains genes associated with conjugative transfer, and Region 1 that contains genes involved plasmid replication and maintenance, encoding the replication initiation poly peptide, a resolvase and partitioning proteins, also as the conjugative nickase (6,8–10). The artA cistron is encoded at one finish of the tra region, divergently transcribed from the other tra genes. The 7 kDa production of the identical homolog from the pSK41-like plasmid pGO1, TrsN, has been shown to bind to the three tra region promoters, P trsN , P trsA and P trsL , and to repress transcription of the latter (11). The equivalent promoters in pSK41 each contain the sequence CATGACA overlapping their −35 sequences (12), and three promoters with this characteristic were subsequently identified within Region 1 (6), including the promoter responsible for transcription of the plasmid'southward parMR type Two partition system (10). These observations suggested that ArtA might act equally a central regulator that coordinates transcription of most pSK41 backbone genes.
The regulation of genes required for conjugative transfer and partition/segregation is critical to plasmid maintenance (13). ArtA shows no sequence homology to any structurally characterized Dna-binding poly peptide and thus how it binds DNA and regulates transcription is unknown. We take therefore carried out cellular, biochemical and X-ray crystallographic studies to determine the role of ArtA in transcriptional regulation of pSK41 genes in vivo and to elucidate its structural mechanism of DNA binding. These data indicate that ArtA is a global regulator of genes critical for pSK41 transmission and that the ArtA protein utilizes dissimilar modes for binding consensus versus atypical DNA operator sites.
MATERIALS AND METHODS
Bacterial strains, growth conditions and plasmids
Bacterial strains and plasmids used in this study are listed in Table one. Bacterial strains were grown at 37°C in LB or on plates containing LB medium and 1.five% w/v Oxoid agar, unless otherwise stated. Due south. aureus electrocompetent cells were prepared using B2 medium as described earlier (xiv). When required, media was supplemented with ampicillin (Ap) 100 µg/ml, cadmium chloride (CdCl2) 0.1 or five µM, neomycin (Nm) 15 µg/ml, tetracycline (Tc) 10 µg/ml and trimethoprim (Tm) 250 µg/ml.
Tabular array 1.
Bacterial strains and plasmids
DNA manipulations
Plasmid Dna was isolated from Escherichia coli using the alkaline lysis method (15) or the Quantum Prep plasmid miniprep kit (Bio-Rad). Cloning in Due east. coli was performed using standard methods and brake enzymes, calf alkaline phosphatase and T4 Deoxyribonucleic acid ligase were purchased from New England Biolabs. Dna fragments were PCR-amplified using 'Taq' (New England Biolabs) or 'Pfu' Turbo DNA polymerase (Stratagene). Automated Dna sequencing was performed by the Australian Genome Inquiry Facility (Academy of Queensland, Commonwealth of australia).
True cat Assays
Chloramphenicol acetyl transferase (CAT) assays based on the method of Shaw (xvi) were adapted to microplate format as described earlier (8). Lysostaphin, acetyl Coenzyme A and 5-five′-dithio-bis[ii-nitrobenzoic acid] were purchased from Sigma Aldrich and bovine serum albumin from New England Biolabs. True cat units are expressed as nanomoles of chloramphenicol acetylated per milligram of protein per minute at 37°C and are the average of at least three contained assays.
Primer extension
Total RNA was extracted using Trizol reagent (Gibco-BRL) from exponential-stage cultures of S. aureus RN4220 containing the advisable plasmid. Glass beads (100 µm; Sigma) in combination with a bead beater (Bio 101) were used for cell lysis. Primer extension was performed as previously described (8) using Thousand-MuLV opposite transcriptase (New England Biolabs) and sequencing ladders were prepared with the SequiTherm EXCEL II Dna sequencing kit (Epicentre Technologies).
Protein overexpression and purification
The pSK41 artA coding region was PCR-amplified and digested with EcoRI and PstI, and cloned into the respective sites of the expression vector pTTQ18RGSH6. An RGSH6 tag was fused to the C-terminal end to facilitate purification of ArtA. The fusion construct, pSK6825, was checked by Dna sequencing and used to transform E. coli BL21(DE3). Recombinant ArtA protein was purified using Ni-NTA chromatography. Pure ArtA was eluted with native elution buffer (50 mM Tris–HCl pH seven.0, 300 mM NaCl, 300 mM imidazole) and aliquots of each purification step were analyzed past SDS-Page. ArtA was then re-buffered into Deoxyribonucleic acid-binding buffer (ten mM Tris–HCl pH 7.v, 10 mM MgCl2, 100 mM NaCl, 0.2 mM DTT, ten% glycerol), using a Sephadex PD10 column (GE Healthcare).
Dna-binding experiments
The pSK41 courage promoter regions were PCR-amplified and end-labeled using [γ32P]ATP (GE Healthcare) and T4 polynucleotide kinase (New England Biolabs). The end-labeled promoter fragments were purified using the illustra™ Deoxyribonucleic acid and Gel Purification Kit (GE Healthcare), eluted in water and stored at −20°C. Electrophoretic mobility shift assays (EMSAs) were performed by incubating the end‐labeled fragments (6000 c.p.m.) with 2 µg of poly[dI-dC] (Sigma Aldrich) and increasing amounts of purified ArtA in Deoxyribonucleic acid-binding buffer (10 mM Tris–HCl pH 7.5, x mM MgCl2, 100 mM NaCl, 0.two mM DTT, x% glycerol). Bounden reactions (xx µl total volume) were incubated for thirty min at room temperature and analyzed using 4% polyacrylamide gels and 0.5 X TBE buffering.
DNase I footprinting was performed using end-labeled promoter fragments (i primer end-labeled prior to PCR-amplification), which were incubated with increasing amounts of purified ArtA using the EMSA conditions described above. The volume of each reaction was brought to 200 µl with DNase I buffer (10 mM Tris–HCl pH 8.0, 5 mM MgCltwo, 1 mM CaCl2, 100 mM KCl, 2 mM DTT, 50 µg/ml BSA, ii µg/ml salmon sperm Dna). DNase I, at a concentration pre-determined to nick ∼50% of the DNA in one case, was added in twenty µl of DNase I buffer and digestion was allowed to go on for ii min at room temperature earlier the add-on of 700 µL of DNase I stop solution (92% ethanol, 3 M sodium acetate, 10 µg/ml salmon sperm DNA). DNA samples were ethanol precipitated and analyzed using denaturing 8% polyacrylamide sequencing gels. Sequencing ladders were prepared using the SequiTherm EXCEL Ii DNA sequencing kit (Epicentre Technologies).
Protein expression and purification for crystallization
For crystallization, ArtA was produced using a different expression construct, besides diffracting crystals could not be obtained with a His-tagged ArtA protein. To produce this construct, the artA gene was cloned into pET-15b (Novagen) using NdeI and XhoI restriction sites, producing a protein containing a cleavable N-terminal His-tag. The protein was purified using Ni2+-NTA chromatography and so dialyzed into digestion buffer (20 mM Tris–HCl pH 8.0, 500 mM NaCl) for 5–half dozen h. Thrombin cleavage (GE Healthcare Biosciences) was then carried out overnight at room temperature to remove the N-terminal His-tag. Finally, gel filtration was applied to remove residual thrombin. ArtA was buffer exchanged and concentrated to 30 mg/ml in 20 mM Tris–HCl pH 8.0, 50 mM NaCl.
Crystallization
For crystallization, a 12 bp dsDNA (5′-GACATGACATGT-three′ and 5′-CACATGTCATGT-3′, Oligos Etc.) was annealed by heating the Deoxyribonucleic acid to 95°C for 5 min, followed past slow cooling at room temperature. The best crystals were obtained using a complex composed of a tooth ratio of one ArtA dimer to one Dna duplex. Crystals were grown by hanging-driblet vapor diffusion using v% (westward/v) PEG 2000, 100 mM Acetate pH iv.60 as a crystallization solution.
Information collection, structure decision and refinement
Because ArtA contains but 1 methionine at its N-terminus, the construction was solved past bromo-MAD phasing using crystals containing bromouracil substitutions for thymines in the Deoxyribonucleic acid operator site (5′-GACAXGACAXGT-3′ and 5′-CACAXGTCAXGT-3′, where X represents 5-bromo-deoxyuridine). The crystals contained an ArtA dimer and Dna duplex in the crystallographic asymmetric unit (ASU) and all four bromine sites were located with SOLVE (17), resulting in a figure of merit of 0.58 to two.80 Å resolution. Model building was carried out using the graphics programs O and Coot (eighteen,19). Afterwards multiple rounds of refinement in CNS (twenty) and re-building, using the high-resolution native information, the R factor/R free converged to 23.nine/26.4% at 2.35 Å resolution. The refinement statistics are summarized in Tabular array 2. The coordinates and structure factors take been deposited with RCSB Protein Information Bank.
Tabular array 2.
Crystallographic information for ArtA–Deoxyribonucleic acid circuitous
| Bromo-Uracil MAD data | |||
| Energy (keV) | 13 474.v/ peak | 13 471.0/ inflection | xiii 800.0/ remote |
| Resolution (Å) | threescore.86–ii.80 | 60.86–2.80 | threescore.86–two.80 |
| Overall R sym(%)a | vi.5 (26.4)b | half-dozen.5 (26.2) | 6.ix (29.3) |
| Overall I/σ(I) | 7.viii (2.seven) | 7.8 (3.2) | 7.vi (2.4) |
| No. of total reflections | 17 763 | 18 131 | 19 789 |
| No. of unique reflections | 4109 | 4129 | 4567 |
| Multiplicity | 4.3 | 4.4 | four.3 |
| Overall effigy of Meritc | 0.580 | ||
| Refinement statistics | |||
| Resolution (Å) | 36.0–2.35 | ||
| Overall R sym(%)a | seven.4 (25.8) | ||
| Overall I/σ(I) | seven.8 (2.8) | ||
| No. of full reflections | 21 181 | ||
| No. of unique reflections | 10 661 | ||
| Complete (%) | 93.1 (93.0) | ||
| R work/R complimentary (%)d | 23.ix/26.4 | ||
| RMSD | |||
| Bond angles (°) | 1.35 | ||
| Bail lengths (A) | 0.008 | ||
| Ramachandran analysis | |||
| Virtually favored (%) | 88.4 | ||
| Additional allowed (%) | 10.5 | ||
| Generously allowed (%) | 1.1 | ||
| Disallowed (%) | 0.0 | ||
Fluorescence polarization assays
Fluorescence polarization (FP) assays of ArtA–DNA binding were performed using a Pavera Beacon Fluorescence Polarization organization (21). All oligonucleotides used in the assays were 5′-fluorescein labeled. For each analysis, increasing concentrations of ArtA were titrated into the binding mixture containing ii nM DNA in 20 mM Tris–HCl pH vii.v, fifty mM NaCl. The excitation and emission wavelengths were 490 and 530 nm, respectively. All data were processed in Kaleidagraph and fit with the equation P = {(P bound – P complimentary)[Protein]/(K d + [Protein])} + P free, where P is the polarization magnitude at a given protein concentration, P free is the initial polarization of the costless oligonucleotide and P jump is the maximum polarization when the oligonucleotide is saturated by ArtA. Not-linear least squares analysis was practical to make up one's mind P spring, and K d. In all assays, poly[dI-dC] (5 µg/ml, Sigma Aldrich) was used as a non-specific binding competitor. FP stoichiometry experiments were carried out past titrating ArtA into a solution with 20 mM Tris–HCl pH 7.5, 50 mM NaCl, ii nM fluoresceinated oligonucleotide and 25-fold backlog non-fluoresceinated oligonucleotide. In all titrations, ane μg/ml poly(dI-dC) was added as a non-specific DNA competitor. All titration curves were fitted by Kaleidagraph.
RESULTS
The ArtA regulon
To found which pSK41 backbone promoters (Effigy i) are regulated by ArtA, the three pSK41 tra promoters and x Region one promoters were amplified from pSK41 by PCR and cloned upstream of the promoterless true cat reporter gene of the promoter-probe vector pSK5483 (8), which facilitates measurement of True cat action as an indicator of promoter strength in South. aureus. CAT assays were performed on whole-cell lysates prepared from S. aureus RN4220 cells harboring individual reporter constructs co-resident with the ArtA expression plasmid pSK7701 or the corresponding control vector pSK7700. Thus in this assay, ArtA responsiveness was indicated past significantly reduced CAT activity from a given pSK41 promoter when co-resident with pSK7701, in comparison to that obtained in the presence of pSK7700.
Genetic map of pSK41 (6). Promoters of the pSK41 courage (Region one and tra region) are denoted past arrows, with arrowheads indicating the direction of transcription. ArtA-regulated genes are colored gray. Resistance genes shown are aacA–aphD and aadD (aminoglycoside resistance), ble (bleomycin resistance) and qacC (antiseptic/disinfectant resistance). Other loci of known function include nes (conjugative nickase), oriT (origin of conjugative transfer), parM and parR (partitioning), rep (replication initiation) and res (multi-mer resolution). Too indicated are the locations of cointegrated plasmids, including pUB110, copies of IS257 and a Tn4001-like transposon.
As shown in Figure 2, six of the promoters tested, P artA , P traA , P traL , P orf538 , P orf259 and P par , were significantly repressed in cells expressing the ArtA protein. The promoters of the two tra region operons, P traA and P traL , were each repressed by >ninety%, equally were P orf538 and P par from Region one. P artA was auto-regulated (82% repression) and P orf259 was the to the lowest degree sensitive ArtA-regulated promoter (51% repression). Half dozen other Region 1 promoters were not regulated by ArtA, including those for the replication initiation factor, rep, the resolvase, res and the conjugative nickase, nes. Additionally, since ArtA had no affect on transcription from P rep , it is likewise expected to have no influence on the promoter for the rep anti-sense regulator RNAI (8), which was present in the P rep -true cat reporter plasmid and hence should have revealed any such regulation; this could not be tested straight because P rnaI -cat constructs announced to be non-viable.
Cat action (n mol of chloramphenicol acetylated per milligram per minute) of the pSK41 backbone promoter reporter constructs in the absence/presence of ArtA. The mean True cat activity of several replicates is shown with error bars denoting the standard deviation. The percentage decrease in Cat activity in the presence of ArtA is shown for each promoter region. NSD, no significant difference.
Primer extension mapping confirmed the being of transcript first points (TSPs) for each of the ArtA-regulated promoters; TSPs for P rep , and P res have been reported previously (viii,ix). The present studies employed RNA isolated from Southward. aureus cells harboring pSK41, and additionally for promoters within Region one, from cells containing the pSK41 derivative pSK5093 that lacks the tra region, and hence artA, due to a deletion resulting from homologous recombination betwixt flanking IS257 elements (6). pSK41-derived RNA facilitated the detection of appropriately located TSPs for P orf259 , P orf538 and P traA (Supplementary Figure S1; Effigy 3). Consistent with artA derepression, pSK5093-derived RNA additionally enabled detection of P par , and yielded more intense signals for both P orf259 and P or538 . TSPs for P artA and P traL were similarly detected in the absenteeism of artA by using RNA isolated from cells harboring the relevant P tra -true cat fusion constructs employed in a higher place (pSK7759 and pSK7761, respectively).
Alignment of the ArtA-regulated pSK41 backbone promoter sequences. The −10 and −35 promoter regions are highlighted in grey and the consensus sequences are shown above. ArtA-protected regions adamant by footprint analysis are underlined. Arrows indicate the transcriptional offset points and dots in the sequence denote gaps.
Depiction of ArtA operators
In EMSAs, purified ArtA poly peptide was shown to bind specifically to Dna fragments containing each of the promoters found to exist repressed past ArtA in CAT assays, simply not those containing the ArtA-insensitive promoters (data non shown). DNase I footprinting was undertaken to localize ArtA binding at each promoter. These studies revealed that the region protected by ArtA encompassed CATGACA sequences that overlay the −35 sequence of each regulated promoter (Supplementary Figure S2; Effigy 3).
Overall structure of ArtA–Dna complex
ArtA shows no sequence homology to any structurally characterized DNA-binding protein. Thus to elucidate the mechanism by which ArtA binds its cognate Dna site, nosotros next crystallized and determined the structure of ArtA leap to a 12-mer Dna duplex containing the ArtA consensus site (top strand; 5′-GACATGACATGT-3′, consensus shown in bold) (Figure 4A). The structure was solved by multiple wavelength anomalous diffraction (MAD) using DNA in which thymines were substituted with 5-Bromo-uracil (see 'Materials and Methods' section). There are 2 ArtA molecules and one 12-mer Dna duplex in the ASU. The structure includes xi bp of the Deoxyribonucleic acid duplex and residues vii–59 of each subunit and has been refined to an R work/R costless of 23.nine/26.four% to ii.35 Å resolution (Tabular array two).
(A) DNA sequence used in crystallization of the ArtA–DNA complex. The ArtA consensus site is colored red and the positions of the thymines that were substituted with 5-bromouracil for MAD phasing are indicated by asterisks. (B) Overall construction of ArtA, one subunit of the dimer is colored in light-green and the other in purple. Shown are two views of the complex related past a xc° rotation. (C) Superimposition of the ArtA dimer subunits showing the conserved nature of the RHH-fold and the distinct conformations adopted by the N-terminal arms. This figure and Figures 5A–C and Effigy 8 were fabricated using PyMOL (7).
The structure reveals that ArtA belongs to the ribbon–helix–helix (RHH) family of Deoxyribonucleic acid-bounden proteins and displays the topology β1–α1–α2 (β1; residues 17–23, α1; residues 26–38, α2; residues 43–59) (Figure 4B). Structural homology searches revealed that the ArtA RHH unit of measurement shows the strongest structural similarity with the transcriptional repressor CopG protein; the ArtA and CopG structures superimpose with a root hateful squared divergence (RMSD) of 1.57 Å for 44 corresponding Cα atoms (22). 2 ArtA subunits tightly acquaintance in the structure to form the functional RHH2 unit. The hydrophobic core of ArtA is extensive and is formed by residues V17, L19 and L21 from the β strand, residues M26, I31, I32, Y34 from α1 and residues L43, I50, L51, L55, I58 from α2.
While the RHH units of each ArtA monomer adopt essentially identical conformations, as underscored by the RMSD of 0.31 Å for superimposition of Cα atoms of residues 17–59, the N-terminal residues 7–16 adopt distinct conformations in each subunit and extend outward towards the Deoxyribonucleic acid (Figure 4C). Indeed, residues from this N-terminal arm provide some interactions with the Deoxyribonucleic acid phosphate backbone (shown below). Withal, all Deoxyribonucleic acid–nucleobase interactions are provided by residues located on the anti-parallel β strands. Notably, specification of the ArtA Deoxyribonucleic acid consensus sequence is mediated by one ArtA dimer (Figure 5A–D). This reveals a significant stardom betwixt ArtA and most other structurally characterized RHH proteins, which bind DNA as dimer-of-dimers (23).
ArtA–Dna interactions. (A) Shut upwards of hydrogen bond interactions betwixt H20 and guanine 6. (B) Stacking interactions between H20 and thymine 5. (C) Interactions between the RHH-loop region and the Dna phosphate backbone. (D) Schematic diagram showing the interactions between ArtA and the DNA site. Residues from unlike subunits of ArtA are colored in blueish (chain A) and cerise (concatenation B), respectively. Hydrogen bond and van der Waals contacts are indicated by arrows and lines, respectively, between the rest and nucleotide. Nucleotides not visible in the crystal structure are colored yellowish.
Operator recognition
In most RHH proteins, iii residues in the ribbon (β-strand) mediate specific interactions with bases in the Dna major groove (eight,23–32). In ArtA, the corresponding residues, S18, H20 and L22, participate in either base of operations specific or phosphate contacts. The L22 side chain makes hydrophobic contacts with Dna ribose groups. In improver, the carbonyl group of L22 forms hydrogen bonds with the Nε of R48′ (where ' ′ ' indicates other subunit of the dimer), which positions the R48 side chain optimally for interaction with the phosphate courage. Finally, the amide nitrogen of L22 interacts with aforementioned phosphate group indirectly via a water mediated contact. Interestingly, the majority of base contacts are made past ane ArtA residue, H20, from each subunit. The environment of the DNA likely influences the side chain H20 pKa as we find that ArtA is able to demark its consensus site with equal affinities at pH values ranging from 4.6 to viii.five (Supplementary Figure S3). The H20 side chain participates in hydrogen bonds, hydrophobic and stacking interactions. Specifically, Nδ of H20 interacts with the N7 of guanine 6 (Figure 5A). The H20 imidazole band also stacks with thymine 7, where the distance between methyl grouping of thymine and imidazole ring of H20 is ∼four Å (Figure fiveB). The Nε of H20 hydrogen bonds with Oγ of S18′ from its dimer mate and this interaction positions the S18 side chain Cβ from one subunit to make hydrophobic contacts with the methyl group of the central thymine base. Notably, this contact from S18 is the only base interaction not provided by H20 (Effigy 5D).
An of import structural characteristic of RHH family unit proteins is a conserved loop motif G-X-Due south/T/N betwixt α2 and α2, which makes contacts with the DNA phosphate backbone and helps dock the RHH onto the DNA (Figure fiveC). These interactions involve direct contacts from amide nitrogens and side bondage near the North-terminus of α2 as well as a positive contribution from the helical dipole of α2, which points straight towards the phosphate courage. In ArtA, the G-X-South/T/N motif is slightly elongated and has a different rest content than other structurally characterized RHH. Nonetheless, it retains a construction like to other RHH proteins and the Northward-terminus of its α2 makes numerous interactions with the DNA phosphate backbone. The Nδ of N42 in the loop interacts with O2P of Adenine 4 and 2 nitrogens of main-chain amides of V43 and S44 contact phosphate backbone atoms O2P and O1P of thymine five (Effigy 5C). Finally, R48 forms table salt bridges with the O1P moiety of Adenine 4.
ArtA-jump DNA conformation
The ArtA-spring Deoxyribonucleic acid is primarily B form in conformation. For example, the average twist of the ArtA-complexed Dna is ∼33.4 Å compared with 34.iii Å for B-DNA. The central consensus site specified by ArtA is non significantly aptitude (33). However, conformational alterations caused by ArtA bounden include major groove widening nearly the bound H20 residues, whereby the DNA major groove width is 15.0 Å compared with 11.7 Å in B-Deoxyribonucleic acid. The minor groove is correspondingly compressed to a width of 4.2 Å, compared with v.7 Å in B-DNA. This Deoxyribonucleic acid distortion in groove width may play some office in transcriptional regulation by affecting binding of the σ factor (run into below).
FP analysis of ArtA-operator bounden
As noted, ArtA is somewhat unique amid RHH proteins in that it binds the cognate TGACA site located in the promoters it regulates as a dimer. However, in addition to its RHH motif, ArtA contains a xvi residue N-terminal arm, parts of which cannot be identified in electron density maps. Interestingly, this extended region (MNNNEENSVFFGKKKK) lies close to the phosphate backbone in the structure and contains four consecutive lysine residues, K13 through K16, indicating that it may play a role in Deoxyribonucleic acid bounden. Indeed, the amide nitrogens of the ii-fold related K16 residues brand contacts to the phosphate backbone while the lysine side chains brand electrostatic interactions with the DNA. The remaining lysine residues appear too far from the DNA to contribute directly to nucleotide binding. Notwithstanding, the Deoxyribonucleic acid we used for crystallization was a 12-mer oligonucleotide containing the minimal ArtA consensus binding site and thus, feasibly, might not exist long enough to provide phosphates for interaction with lysine residues in the extended arm. This prompted us to enquire whether this region might play a part in bounden longer DNA sites. To address this possibility, a truncation mutant, Δ14ArtA, was made in which the first xiv amino acids were removed. FP studies were then carried out to analyze the DNA-binding activities of the wild-type ArtA and the truncation mutant Δ14ArtA. Three oligonucleotides of dissimilar length (11-, sixteen- and 22-mer) were designed based on the consensus binding site in the ArtA-regulated promoters to assay Deoxyribonucleic acid binding to the minimal versus longer DNA sites. The results are summarized in Tabular array iii. These studies revealed no differences in the bounden affinities of the 16- and 22-mer DNA sites for ArtA and Δ14ArtA and a very minor, or 2-fold decrease, in wild-type ArtA and Δ14 ArtA bounden to the 11-mer compared with the 16- and 22-mer. The slight reduction in DNA binding of ArtA to the xi-mer compared with the longer sites may indicate that residues other than those in the N-terminal arms are providing modest contributions to Deoxyribonucleic acid binding to longer sites, likely to the phosphate backbone. Notwithstanding, 2-fold differences in binding are on the order of one to a few weak interactions and indicate that the binding to the curt site is essentially the same as to longer sites. In any example, the data clearly prove that the Northward-final arms are non important for high-affinity bounden to these single site operators.
Tabular array 3.
K dS of ArtA and Δl4ArtA binding to operator Dna sites
| Oligonucleotides | ArtA-One thousand d(nM) | Δ14ArtA-G d (nM) |
|---|---|---|
| ACATGACATGT | 127 + 5 | 222 + 8 |
| ACATGACATGACATGT | lx + 3 | 58 + 3 |
| CAAACATGATATGACATGTAAT | 62 + half dozen | 58 + five |
| TTGTCATGACATGTCATGTGTAA (P artA ) | 28 + viii | 41 + nine |
| TTACATGACATGACATGTAATAC (P traA ) | 42 + 9 | 52 + half-dozen |
| TGCATTACATGACATGACATGTAAT (P traL ) | 23 + 5 | 39 + five |
| ACATGACAGGT (P orf259 ) | 790 + 34 | – |
| TAAACATTGCATAACATGACAGGT (P orf259 ) | – | – |
| ACACGACATCA (P orf538 ) | – | – |
| AAATGACACGT (P orf538 ) | – | – |
| ACACGACATGAAATGACACGT (P orf538 ) | 58+5 | – |
| ACACTAAATGAAATGACACGT (Mutant 1) | – | – |
| ACACGACATGAAATTAAACGT (Mutant 2) | – | – |
Interestingly, similar P par , the promoters for P traL and P traA contain 2 consecutive TGACA motifs that multiple ArtA molecules might demark. However, modeling shows that two ArtA dimers cannot dock simultaneously onto DNA-containing face-to-face TGACA repeats such as in P par , P traL and P traA without steric clash. These combined data are consistent with the idea that dimeric ArtA is the functional Deoxyribonucleic acid-binding unit for these promoter operators. Moreover, these data as well signal that, in these cases, the long N-last arms of ArtA exercise non contribute to DNA bounden by either contacting the Dna or participating in protein–poly peptide interactions that help DNA binding. Indeed, FP experiments examining bounden to the total length promoter operators of P par , P artA , P traA and P traL showed no difference in bounden affinity betwixt the wildtype and Δ14 mutant of ArtA and the binding affinities were essentially the same every bit obtained for the single ArtA consensus site (Tabular array iii).
The lower bounden affinity of ArtA for its operator in P orf259 (790 nM compared with 127 nM for the optimal site) may exist explained by the fact that information technology contains a single base difference compared with the consensus ArtA-bounden site (in position 9 in which the T is changed to G). The phosphate grouping of this nucleotide interacts extensively with N cap of α2 and these contacts may be influenced past nucleotide identity (Figure 5D). Notably, the reduced affinity of ArtA for P orf259 is consistent with the finding that P orf259 was the to the lowest degree sensitive of the ArtA-regulated promoters (Effigy 2). The ArtA DNase I footprint data obtained for each of the six ArtA-regulated promoters (Supplementary Effigy S2; Figure 3) are in good agreement with our FP data. Yet, the protected regions determined hither are markedly smaller than those described previously for the ArtA homolog, TrsN (11). The larger footprints observed in that study, notwithstanding, are likely attributable to the much larger TrsN fusion poly peptide, which independent a glutathione S-transferase analogousness tag.
Interestingly, one operator bound by ArtA, P orf538 , presented a paradox. Although this site is regulated by ArtA, an obvious consensus site within the promoter is unclear. Ii possible matches that are close to the consensus were identified (Figure 3; Table 3). Individually, neither of these sites showed detectable binding as measured by FP. Nevertheless, the 21-mer oligonucleotide, which covers both sites was found to bind wild-type ArtA saturably, with a M d of 58 nM. Because this site contains two possible binding motifs (Table iii) only neither is sufficient for Deoxyribonucleic acid bounden, we reasoned that this site might bind two ArtA dimers. Indeed, modeling revealed that ii ArtA dimers would bind on the same side of the Deoxyribonucleic acid duplex on this operator (Supplementary Figure S4). This binding mode shows no steric clash and critically, the N-terminal arm of 1 subunit is juxtaposed adjacent to the next molecule in the neighboring dimer, suggesting that ArtA may utilise its N-terminal artillery in poly peptide–protein interactions when binding to P orf538 . If this is the case, the ArtA truncation mutant should display weakened binding to this site. Indeed, FP experiments showed that removal of the N-terminal artillery essentially abrogated binding to the 21-mer P orf538 site (Effigy 6). To further examination the P orf538 dimer-of-dimer model, ii P orf538 mutants were designed (Mutant 1: ACACTAAATGAAATGACACGT; Mutant 2: ACACGACATGAAATTAAACGT). In each of these oligonucleotides, the ii key bases involved in H20 recognition (Thou and C) were mutated (Chiliad to T and C to A). As predicted, none of these mutant oligonucleotides were bound by ArtA, consistent with the previous result that ArtA cannot bind either 12-mer oligonucleotide with only ane binding site derived from P orf538 . In contrast, as noted, previous FP experiments revealed that both Δ14 ArtA and wild-type ArtA bound the full length promoter regions of Ppar , PartA , PtraA and PtraL with the aforementioned analogousness as the single ArtA consensus site, consistent with a single ArtA dimer binding to these promotors.
FP binding isotherms for wild type ArtA and Δ14ArtA binding to the 21-mer Deoxyribonucleic acid sites from P orf538 . Filled diamond represents the curve for wild-type ArtA binding to P orf538 . Filled squares for Δ14ArtA binding to P orf538 . Filled triangles for wild-type ArtA binding to the oligonucleotide mutant 1 P orf538 site. Filled circles for wild-type ArtA binding to the oligonucleotide mutant 2 P orf538 site. FP units (mP, millipolarization) and ArtA concentrations are along the y- and ten-centrality, respectively.
Finally, we utilized FP to directly define the stoichiometry of ArtA bounden to the P orf538 site and to the consensus operator site. These studies, which showed that ii ArtA subunits (i.e. a ArtA dimer) spring the consensus operator site, while P orf538 is bound by four ArtA subunits, are consistent with the model that ArtA binds P orf538 as a dimer-of-dimers and the consensus sites equally but a dimer (Effigy 7). While the inflection point on the ArtA-consensus site bend is typical of most DNA-binding proteins in that, after all the Deoxyribonucleic acid sites are saturated, the curve is primarily flat, information technology is interesting that although the inflection indicate in the ArtA–P orf538 curve is articulate and indicates saturation of the specific sites by four ArtA subunits, addition of more than ArtA poly peptide in this instance does non pb to a flat curve but an additional increase. This suggests that after the specific sites are saturated, more ArtA molecules non-specifically interact with either the protein or the DNA. Thus, the combined data show that ArtA binds DNA utilizing different modes of binding. In the case of the P par , P artA , P traA , P traL and P orf259 operators, ArtA binds as a dimer and there are no protein–poly peptide interactions involved in this bounden outside the contacts betwixt subunits in the dimer. In contrast, ArtA binds to the atypical P orf538 operator as a dimer-of-dimers and utilizes, in addition to its RHH, its extended N-terminal arms, presumably for mediating dimer–dimer contacts.
Stoichiometry of ArtA–Dna bounden by FP. (A) Titration curve of ArtA into the consensus 12-mer used in crystallization resulted in a molar ratio of ArtA subunit to Deoxyribonucleic acid duplex of ∼2. (B) ArtA titrated into the 21-mer DNA sites containing P orf538 resulted in a molar ratio of ArtA subunit to DNA duplex of ∼4.
ArtA transcription repression mechanism
Notably, the ArtA-binding sites within the P par , P artA , P traA and P traL promoters overlap the −35 motifs, while the ArtA-binding site within the P orf259 promoter is located slightly downstream of the −35 position. Finally, the ArtA-binding site within the P orf538 promoter, which nosotros find ArtA binds as a dimer-of-dimers, extends over the unabridged −35 box. Thus, all the ArtA-bounden sites overlap or impinge on the −35 boxes of the promoters that information technology regulates. This suggested that ArtA may repress transcription past preventing binding of the sigma factor. Regions 4 of sigma factors, which specify binding to the −35 boxes of the promoters, are very conserved among bacteria (34−36). The structure of the Thermus aquaticus sigma Region 4–DNA complex has been solved and tin serve as a model for the S. aureus sigma Region four–Dna complex as the two share 79% sequence similarity and importantly, all the residues involved in −35 box bounden are identical between the two proteins (36). The nucleotides within the −35 box in the promoters bound by ArtA are ATGACA instead of the typical −35 TTGACA. Superposition of the T. aquaticus Sigma A Region 4–DNA complex onto ArtA–Deoxyribonucleic acid complex using the conserved TGACA −35 box region equally a guide shows explicitly that bounden of ArtA would completely block the binding of Region four of Southward. aureus sigma factor A at the −35 box (Figure 8). Furthermore, the Dna distortion induced by ArtA bounden would also hinder the accessibility of the sigma factor. Thus, these data betoken that ArtA represses transcription past physically blocking access of the promoter to the sigma factor and past altering the DNA conformation such that sigma bounden would exist unfavorable.
Overlay of σ4-Dna (coordinates 1KU7) and ArtA–DNA complexes indicating that ArtA binding would prevent σ4 binding to the −35 promoter site. The phosphate courage of the TGACA Deoxyribonucleic acid sites (−35 site) of the σ4-Dna (wheatish) and ArtA–Deoxyribonucleic acid (light blue) complexes were superimposed. For reference the −35 TGACA site is colored red.
Give-and-take
We have shown hither that ArtA represses half dozen promoters in Region 1 and the tra region of pSK41. All only P artA itself and P orf259 are likely to direct transcription of operons. As a consequence, ArtA is expected to regulate the expression of 21 out of a total of 30 coding sequences contained within the pSK41 backbone (Figure 1). Information technology should be noted that the only operon promoter non regulated past ArtA, P orf204 , corresponds to an example of an IS257-hybrid promoter where the −35 sequence is located within the terminal inverted repeat of the upstream IS257 that is partnered to a fortuitously located −10 sequence present in the flanking sequence. Such IS257-hybrid promoters take previously been shown to straight transcription of resistance genes (37,38). It was hypothesized that the acquisitions of IS257 elements and associated resistance genes are recent evolutionary events and that Region one and the tra region were previously contiguous in a pSK41 antecedent (half dozen). If correct, it is probable that transcription of orf204 and orf423 would have initiated at P traL , and hence would besides accept been under the command of ArtA. With regard to this, it is worth noting that pSK41-like plasmids have at present been identified where the Region 1 and tra region termini evident in pSK41 are indeed face-to-face. In the mupirocin resistance plasmid pV030–8 (GenBank entry {"type":"entrez-nucleotide","attrs":{"text":"EU366902","term_id":"165880082","term_text":"EU366902"}}EU366902), the truncated remnant nowadays at the end of the pSK41 tra region, orf55 (Figure 1), corresponds to a 242 codon ORF, which is immediately followed by a 207 codon ORF and and then orf204 and orf423 homologues. Therefore, in pV030–8 P traL probably directs transcription of a six gene operon. Transposon mutagenesis and complementation studies of pGO1 betoken that trsL and/or trsM are required for conjugative transfer (39), then these co-transcribed genes may besides exist associated with this function. Although the majority of ArtA-regulated genes are involved in conjugative transfer, ArtA also participates in the repression of P par , which transcribes the functional parMR type 2 partitioning system. This operon is too machine-regulated by the centromere binding protein ParR, which like ArtA, contains a RHH DNA-binding fold (10). Thus, transcription of the par operon is field of study to two levels of command, mediated past 2 unlike proteins that utilise RHH folds specific for distinct Dna-binding sites.
The RHH DNA-binding motif is a common Dna-binding motif plant in prokaryotes (23). Indeed, ∼2000 RHH-domain containing protein sequences have been identified. To date, >15 structures have been determined of RHH proteins in their apo or DNA-spring forms. A characteristic characteristic of almost RHH proteins is that they recognize their DNA sites by forming dimer-of-dimers. This increases specificity in Deoxyribonucleic acid bounden through the formation of Deoxyribonucleic acid base contacts from two dimeric modules equally a single RHH module can but specify ∼vi nt in 1 major groove. Indeed, several RHH proteins take been shown to bind cooperatively to extended DNA segments to course superstructures on Deoxyribonucleic acid. This was first demonstrated for the RHH poly peptide CopG (40). Subsequently, such cooperative bounden by the pSK41 ParR poly peptide was shown to pb to the germination of a specific superhelical partition circuitous that is critical for plasmid DNA segegation by the type II ParR-ParM proteins (ten). Therefore, it is interesting that ArtA appears to display altered ability in how it binds Deoxyribonucleic acid in that it functionally represses nigh of its promoters past binding every bit a dimer, only can also bind a not-approved DNA operator as a dimer-of-dimers.
The formation of ArtA dimer-of-dimers was shown to exist dependent on its Northward-terminal arm regions. Long N-terminal regions have been constitute in the RHH proteins MetJ, ParR and Omega repressor (10,24,25). However, in these proteins, the N-concluding arms play dissimilar roles than they exercise in ArtA. Specifically, the N-concluding regions of MetJ fold dorsum and collaborate with Helix ii and are involved in binding to the MetJ corepressor, Due south-adenosylmethionine and the Due north-last regions of ParR and the Omega repressor are known to interact with their respective sectionalization NTPase partner proteins, ParM and Delta, respectively (x,25,26). Thus, the utilization of Due north-last arms to mediate RHH dimer-of-dimer interactions is so far unique to ArtA. The formation of dimer-of-dimers by other RHH proteins has been shown to involve different regions and sometimes domains of each poly peptide. Examples include Arc (27), MetJ (24), NikR (28), FitAB (29) and ParR (10). In these cases, the binding sites for each dimer are normally arranged every bit inverted repeats. In contrast, the ArtA-binding sites in P orf538 are arranged as direct repeats. One farther instance of a RHH poly peptide that appears to function as a dimer in DNA bounden is the East. coli proline utilization poly peptide A (PutA). Nevertheless, the only other RHH poly peptide that may role similarly to ArtA in being capable of binding as a dimer or dimer-of-dimers is the F plasmid TraY protein (41). Although the construction of TraY has not yet been solved, the protein sequence contains ii directly repeats that are predicted to each comprise a RHH-fold. If this is the case, TraY forms a monomeric RHHii-fold. Biochemical studies have suggested that it can bind either every bit a monomer (mimicking a RHH dimer) or a dimer (mimicking a RHH dimer of dimers). Whether these proposed modes of binding are relevant in vivo, however, has not yet been adamant.
Although the RHH proteins, Mnt repressor and ParR contain histidines in their ribbon, ArtA is the beginning RHH protein observed to utilize histidine as its master sequence specifying rest. In the ParR–Dna structure, the side chain of ParR balance H8 faces the hydrophobic core rather than the Dna and although biochemical data advise that Mnt uses H6 for Deoxyribonucleic acid contacts, in that location are no structures available for a Mnt–Deoxyribonucleic acid circuitous, so this remains to be determined (10,32). ArtA is notable in that not only does it utilize H20 in base contacts, but, in fact, it also relies on this residue for mediating about all its base of operations specifying interactions. The histidine side chain is somewhat unique in that information technology has the ability to grade hydrophobic contacts, stacking interactions and multiple hydrogen bonds all of which tin result in a specific interaction with a given ligand depending on the binding context. In ArtA, the H20 residues make stacking interactions with the fundamental five nucleotides. Stacking interactions between aromatic residues and nucleobases have recently been suggested to play important roles in specific bounden of proteins to their DNA targets (42,43). In addition, the H20 residues too brand specific hydrophobic interactions with the methyl groups of thymine 4A and thymine 6B. Finally, the ii-fold related H20s likewise hydrogen bond with guanine 5A and guanine 7B. Equally a result, the ArtA H20 residues alone are able to almost entirely mediate specific operator binding.
Our FP and footprinting studies bear witness that ArtA binds operator sites that overlap or are side by side to the −35 box of each promoter suggesting that ArtA may part to repress transcription by physically blocking binding of Sigma A to these promoters. Modeling shows clearly that ArtA and Sigma A cannot bind the −35 region simultaneously. Moreover, ArtA also alters the Dna construction to i that is not favorably leap by Sigma A, Region 4. Thus, together these findings provide a mechanism for ArtA-mediated transcription repression.
The data presented indicates that ArtA coordinately regulates the expression of most cognate pSK41 coding sequences via transcriptional repression. The genes controlled include plasmid housekeeping functions such equally plasmid partitioning and conjugation, as well as genes for which functions are nonetheless to exist ascribed. ArtA presumably sets a basal level of activity from its target promoters, which may be subject to boosted levels of control, as in the instance of P par . However, the possibility that the expression or activity of ArtA itself might exist discipline to exogenous control cannot be excluded. Tight command of plasmid gene expression is expected to enhance evolutionary fitness by reducing the burden of plasmid carriage on the host cell. As such, the ArtA regulatory system, which is highly conserved across the pSK41 plasmid family unit, likely contributes to the capacity of these clinically significant plasmids to confer multiple and diverse antimicrobial resistance phenotypes.
FUNDING
Thou.D. Anderson Trust Fellowship and the National Institutes of Health (grant GM068453; to M.A.Southward.); Academy of Sydney R&D Grant (to Due north.F., 1000.H.B. and R.A.S.); National Health and Medical Research Quango of Australia Project (grant 457454 to Due north.F., M.A.S., S.M.K., S.O.J. and R.A.S.). Funding for open access charge: National Institutes of Health.
Conflict of interest argument. None declared.
Supplementary Material
ACKNOWLEDGEMENTS
We thank the Advanced Light Source (ALS) and their support staff. The ALS is supported by the Managing director, Office of Science, Office of Basic Energy Sciences and Cloth Science Division of the US Department of Energy at the Lawrence Berkeley National Laboratory.
REFERENCES
one. Goetghebeur M, Landry PA, Han D, Vicente C. Methicillin-resistant Staphylococcus aureus: a public health issue with economic consequences. Tin. J. Infect Dis. Med. Microbiol. 2007;18:27–34. [PMC costless article] [PubMed] [Google Scholar]
two. Deurenberg RH, Vink C, Kalenic South, Friedrich AW, Bruggeman CA, Stobberingh EE. The molecular evolution of methicillin-resistant Staphylococcus aureus. Clin. Microbiol. Infect. 2007;13:222–235. [PubMed] [Google Scholar]
3. Clements A, Halton K, Graves N, Pettitt A, Morton A, Looke D, Whitby One thousand. Overcrowding and understaffing in modern health-intendance systems: key determinants in meticillin-resistant Staphylococcus aureus transmission. Lancet Infect. Dis. 2008;8:427–434. [PubMed] [Google Scholar]
4. Navarro MB, Huttner B, Harbarth S. Methicillin-resistant Staphylococcus aureus command in the 21st century: beyond the astute care hospital. Curr. Opin. Infect. Dis. 2008;21:372–379. [PubMed] [Google Scholar]
5. Firth N, Skurray RA. The Staphylococcus-genetics: accessory elements and genetic substitution. In: Fischetti VA, Novick RP, Ferretti JJ, Portnoy DA, Rood JI, editors. Gram-Positive Pathogens. 2d edn. Washington DC: American Society for Microbiology; 2006. pp. 413–426. [Google Scholar]
six. Berg T, Firth N, Apisiridej Due south, Hettiaratchi A, Leelaporn A, Skurray RA. Complete nucleotide sequence of pSK41: evolution of staphylococcal conjugative multiresistance plasmids. J. Bacteriol. 1998;180:4350–4359. [PMC free article] [PubMed] [Google Scholar]
vii. Delano WL. San Carlos, CA: Delano Scientific; 2002. The PyMOL molecular graphics system. [Google Scholar]
8. Kwong SM, Skurray RA, Firth North. Staphylococcus aureus multiresistance plasmid pSK41: analysis of the replication region, initiator poly peptide binding and antisense RNA regulation. Mol. Microbiol. 2004;51:497–509. [PubMed] [Google Scholar]
9. LeBard RJ, Jensen And then, Arnaiz IA, Skurray RA, Firth N. A multimer resolution organisation contributes to segregational stability of the prototypical staphylococcal conjugative multiresistance plasmid pSK41. FEMS Microbiol. Lett. 2008;284:58–67. [PubMed] [Google Scholar]
10. Schumacher MA, Glover TC, Brzoska AJ, Jensen And so, Dunham TD, Skurray RA, Firth Northward. Segrosome structure revealed past a complex of ParR with centromere DNA. Nature. 2007;450:1268–1271. [PubMed] [Google Scholar]
11. Sharma VK, Johnston JL, Morton TM, Archer GL. Transcriptional regulation past TrsN of conjugative transfer genes on staphylococcal plasmid pGO1. J. Bacteriol. 1994;176:3445–3454. [PMC free commodity] [PubMed] [Google Scholar]
12. Firth N, Ridgway KP, Byrne ME, Fink PD, Johnson L, Paulsen It, Skurray RA. Analysis of a transfer region from the staphylococcal conjugative plasmid pSK41. Gene. 1993;136:thirteen–25. [PubMed] [Google Scholar]
xiii. Thomas CM. Transcription regulatory circuits in bacterial plasmids. Biochem. Soc. Trans. 2006;34:1072–1074. [PubMed] [Google Scholar]
14. Schenk S, Laddaga RA. Improved methods for electroporation of Staphylococcus aureus. FEMS Microbiol. Lett. 1992;73:133–138. [PubMed] [Google Scholar]
xv. Birnboim HC, Doly J. A rapid element of group i extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 1979;7:1513–1523. [PMC free article] [PubMed] [Google Scholar]
16. Shaw WV. Chloramphenicol acethyltransferase from chloramphenicol-resistant bacteria. Methods Enzymol. 1975;43:737–355. [PubMed] [Google Scholar]
17. Terwilliger TC, Berendzen J. Automated MAD and MIR structure solution. Acta Crystallogr. D Biol. Crystallogr. 1999;55:849–861. [PMC free article] [PubMed] [Google Scholar]
eighteen. Jones TA, Zou JY, Cowan SW, Kjeldgaard M. Improved methods for edifice protein models in electron density maps and the location of errors in these models. Acta Crystallogr. A. 1991;47(Pt two):110–119. [PubMed] [Google Scholar]
19. Emsley P, Cowtan K. Coot: model-building tools for molecular graphics. Acta Crystallogr. D Biol. Crystallogr. 2004;60:2126–2132. [PubMed] [Google Scholar]
20. Brunger AT, Adams PD, Clore GM, DeLano WL, Gros P, Grosse‐Kunstleve RW, Jiang JS, Kuszewski J, Nilges M, Pannu NS, et al. Crystallography & NMR system: a new software suite for macromolecular construction determination. Acta Crystallogr. D Biol. Crystallogr. 1998;54:905–921. [PubMed] [Google Scholar]
21. Lundblad JR, Laurance Thou, Goodman RH. Fluorescence polarization analysis of protein-DNA and protein-protein interactions. Mol. Endocrinol. 1996;10:607–612. [PubMed] [Google Scholar]
22. Gomis-Ruth FX, Sola Grand, Acebo P, Parraga A, Guasch A, Eritja R, Gonzalez A, Espinosa M, del Solar Chiliad, Coll 1000. The structure of plasmid-encoded transcriptional repressor CopG unliganded and bound to its operator. EMBO J. 1998;17:7404–7415. [PMC free article] [PubMed] [Google Scholar]
23. Schreiter ER, Drennan CL. Ribbon–helix–helix transcription factors: variations on a theme. Nat. Rev. Microbiol. 2007;5:710–720. [PubMed] [Google Scholar]
24. Somers WS, Phillips SE. Crystal structure of the met repressor-operator complex at 2.8 A resolution reveals Deoxyribonucleic acid recognition by beta-strands. Nature. 1992;359:387–393. [PubMed] [Google Scholar]
25. Weihofen WA, Cicek A, Pratto F, Alonso JC, Saenger West. Structures of omega repressors leap to direct and inverted DNA repeats explain modulation of transcription. Nucleic Acids Res. 2006;34:1450–1458. [PMC free commodity] [PubMed] [Google Scholar]
26. Dmowski M, Sitkiewicz I, Ceglowski P. Characterization of a novel partition system encoded by the delta and omega genes from the streptococcal plasmid pSM19035. J. Bacteriol. 2006;188:4362–4372. [PMC free article] [PubMed] [Google Scholar]
27. Raumann Exist, Rould MA, Pabo CO, Sauer RT. DNA recognition by beta-sheets in the Arc repressor-operator crystal construction. Nature. 1994;367:754–757. [PubMed] [Google Scholar]
28. Schreiter ER, Sintchak MD, Guo Y, Chivers PT, Sauer RT, Drennan CL. Crystal structure of the nickel-responsive transcription factor NikR. Nat. Struct. Biol. 2003;10:794–799. [PubMed] [Google Scholar]
29. Mattison M, Wilbur JS, So M, Brennan RG. Structure of FitAB from Neisseria gonorrhoeae bound to Deoxyribonucleic acid reveals a tetramer of toxin-antitoxin heterodimers containing pin domains and ribbon-helix-helix motifs. J. Biol. Chem. 2006;281:37942–37951. [PubMed] [Google Scholar]
30. Zhou Y, Larson JD, Bottoms CA, Arturo EC, Henzl MT, Jenkins JL, Nix JC, Becker DF, Tanner JJ. Structural basis of the transcriptional regulation of the proline utilization regulon past multifunctional PutA. J. Mol. Biol. 2008;381:174–188. [PMC free commodity] [PubMed] [Google Scholar]
31. Gu D, Zhou Y, Kallhoff 5, Baban B, Tanner JJ, Becker DF. Identification and characterization of the DNA-binding domain of the multifunctional PutA flavoenzyme. J. Biol. Chem. 2004;279:31171–31176. [PMC free article] [PubMed] [Google Scholar]
32. Knight KL, Sauer RT. Biochemical and genetic analysis of operator contacts fabricated by residues inside the beta-sail Dna binding motif of Mnt repressor. EMBO J. 1992;eleven:215–223. [PMC free article] [PubMed] [Google Scholar]
33. Ravishanker K, Swaminathan Due south, Beveridge DL, Lavery R, Sklenar H. Conformational and helicoidal analysis of 30 PS of molecular dynamics on the d(CGCGAATTCGCG) double helix: 'curves', dials and windows. J. Biomol. Struct. Dyn. 1998;6:669–699. [PubMed] [Google Scholar]
34. Helmann JD, Chamberlin MJ. Structure and function of bacterial sigma factors. Annu. Rev. Biochem. 1988;57:839–872. [PubMed] [Google Scholar]
35. Gruber TM, Bryant DA. Molecular systematic studies of eubacteria, using sigma70-blazon sigma factors of group one and group 2. J. Bacteriol. 1997;179:1734–1747. [PMC gratuitous article] [PubMed] [Google Scholar]
36. Campbell EA, Celenov M, Sun JL, Olson CA, Weinman O, Trester-Zeditz ML, Darst SA. Structure of the bacterial RNA polymerase promoter specificity sigma subunit. Mol. Cell. 2002;9:527–539. [PubMed] [Google Scholar]
37. Leelaporn A, Firth Northward, Paulsen IT, Skurray RA. IS257-mediated cointegration in the development of a family of staphylococcal trimethoprim resistance plasmids. J. Bacteriol. 1996;178:6070–6073. [PMC free article] [PubMed] [Google Scholar]
38. Simpson AE, Firth N, Skurray RA. An IS257-derived hybrid promoter directs transcription of a tetA(K) tetracycline resistance gene in the Staphylococcus aureus chromosomal mec region. J. Bacteriol. 2000;182:3345–3352. [PMC costless article] [PubMed] [Google Scholar]
39. Morton TM, Eaton DM, Johnston Jl, Archer GL. Dna sequence and units of transcription of the conjugative transfer cistron complex (trs) of Staphylococcus aureus plasmid pGO1. J. Bacteriol. 1993;175:4436–4447. [PMC free article] [PubMed] [Google Scholar]
xl. Costa M, Sola M, del Solar G, Eritja R, Hernandez-Arriaga AM, Espinosa M, Gomis-Ruth FX, Coll M. Plasmid transcriptional repressor CopG oligomerizes to render helical superstructures unbound and in complexes with oligonucleotides. J. Mol. Biol. 2001;310:403–417. [PubMed] [Google Scholar]
41. Nelson WC, Matson SW. The F plasmid traY cistron product binds Deoxyribonucleic acid as a monomer or a dimer: structural and functional implications. Mol. Microbiol. 1996;xx:1179–1187. [PubMed] [Google Scholar]
42. Tao F, Goswami J, Bernasek SL. Competition and coadsorption of di-acids and carboxylic acrid solvents on HOPG. J. Phy. Chem. B. 2006;110:19562–19569. [PubMed] [Google Scholar]
43. Lesley R, Rutledge LSCV, Stacey DW. Characterization of the stacking interactions between DNA or RNA nucleobases and the aromatic amino acids. Chem. Phys. Lett. 2007;444:167–175. [Google Scholar]
44. Kreiswirth BN, Lofdahl S, Betley MJ, O'Reilly M, Schlievert PM, Bergdoll MS, Novick RP. The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature. 1983;305:709–712. [PubMed] [Google Scholar]
45. Stark MJ. Multicopy expression vectors carrying the lac repressor factor for regulated high-level expression of genes in Escherichia coli. Gene. 1987;51:255–267. [PubMed] [Google Scholar]
46. Yanisch-Perron C, Vieira J, Messing J. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene. 1985;33:103–119. [PubMed] [Google Scholar]
47. Novick RP, Richmond MH. Nature and interactions of the genetic elements governing penicillinase synthesis in Staphylococcus aureus. J. Bacteriol. 1965;90:467–480. [PMC free commodity] [PubMed] [Google Scholar]
48. Firth Due north, Apisiridej S, Berg T, O'Rourke BA, Curnock Southward, Dyke KGH, Skurray RA. Replication of staphylococcal multiresistance plasmids. J. Bacteriol. 2000;182:2170–2178. [PMC free commodity] [PubMed] [Google Scholar]
49. Kwong SM, Skurray RA, Firth N. Replication command of staphylococcal multiresistance plasmid pSK41: an antisense RNA mediates dual-level regulation of Rep expression. J. Bacteriol. 2006;188:4404–4412. [PMC gratuitous article] [PubMed] [Google Scholar]
50. Kwong SM, Lim R, LeBard RJ, Skurray RA, Firth N. Analysis of the pSK1 replicon, a image from the staphylococcal multiresistance plasmid family. Microbiol. 2008;154:3084–3094. [PubMed] [Google Scholar]
Manufactures from Nucleic Acids Research are provided here courtesy of Oxford University Printing
Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2777438/
0 Response to "The Term ââåkinetic Artã¢ââ Is a Type of Art"
Post a Comment